Sequence ID | >WENV180866030 |
Genome ID | ODLJ01003166 |
Search identical group | |
Phylum/Class | [ODLJ] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 5872 |
End posion on genome | 5948 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tttatataaT |
tRNA gene sequence |
GTCTCAGTAGCTCAGCAGGATAGAGCAACGGCCTTCTAAGCCGTCGGTCAGGGGTTCGAA |
Downstream region at tRNA end position |
taaggagtag |
Secondary structure (Cloverleaf model) | >WENV180866030 Arg TCT T GTCa taaggagtag G - C T - A C - G T + G C - G A - T G - C T A T T T C C C A C G A A | + | | | G A C T C G A G G G G C G | | | | T T G G A G C A T A A CGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |