Sequence ID | >WENV180869140 |
Genome ID | ODLM01007467 |
Search identical group | |
Phylum/Class | [ODLM] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 1445 |
End posion on genome | 1528 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tctgataaaT |
tRNA gene sequence |
GGGCAGATTCCCGAGTGGCCAAAGGGGACAGACTGTAAATCTGCTGCAATTTGCTTCGGT |
Downstream region at tRNA end position |
tgtattgtcc |
Secondary structure (Cloverleaf model) | >WENV180869140 Tyr GTA T ATtg tgtattgtcc G - C G - C G - C C - G A - T G - C A - T T A T C C A C C A T G A T | | | | | G G G C C C G G T G G C G | | | T T C A G G G C A A G TGCAATTTGCTTC A C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |