Sequence ID | >WENV180878854 |
Genome ID | ODLY01000343 |
Search identical group | |
Phylum/Class | [ODLY] human metagenome; G_DNA_Anterior nares |
Species | |
Start position on genome | 4311 |
End posion on genome | 4237 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
gcatccgtgt |
tRNA gene sequence |
GGGGCTATAGCTCAGTCGGTTAGAGCTCCGGACTCATAATCCGTCGGTCCCGGGTTCGAG |
Downstream region at tRNA end position |
tagaaggagg |
Secondary structure (Cloverleaf model) | >WENV180878854 Ile2 CAT t ACgg tagaaggagg G - C G - C G - C G - C C - G T + G A - T C G T G G C C C A T G A A | | | | | G C C T C G C C G G G C G | | | | T T G G A G C T T A T CGGTC C T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |