Sequence ID | >WENV180880138 |
Genome ID | ODLZ01008362 |
Search identical group | |
Phylum/Class | [ODLZ] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 1986 |
End posion on genome | 2061 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tctgacacat |
tRNA gene sequence |
TCCTCGATAGCTCAGTCGGTAGAGCGTCTGACTGTTAATCAGAATGTCACTGGTTCGAGT |
Downstream region at tRNA end position |
tttgaatctt |
Secondary structure (Cloverleaf model) | >WENV180880138 Asn GTT t GCCA tttgaatctt T - A C - G C - G T - A C - G G - C A - T T G T T G A C C A T G A A | | | | | G C C T C G A C T G G C G | | | | T T G G A G C T A G ATGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |