Sequence ID | >WENV180881577 |
Genome ID | ODMA01005634 |
Search identical group | |
Phylum/Class | [ODMA] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 1071 |
End posion on genome | 1143 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tcaaacgcat |
tRNA gene sequence |
TCCTGCGTAGCTCAATGGCAGAGCATCCGACTGTTAATCGGACGGTTGCTGGTTCGAGTC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV180881577 Asn GTT t GCnn nnnnnnnnnn T - A C - G C - G T - A G - C C - G G - C T G T C G A C C A A A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C C A A CGGTT T - A C - G C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |