Sequence ID | >WENV180889466 |
Genome ID | ODMN01045239 |
Search identical group | |
Phylum/Class | [ODMN] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 190 |
End posion on genome | 276 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ggtgcggcct |
tRNA gene sequence |
GGAGAGGTGACAGAGCGGCCGAATGTGGCGGTCTTGAAAACCGCTGTGCGCCTGGCGCAC |
Downstream region at tRNA end position |
aagtattgca |
Secondary structure (Cloverleaf model) | >WENV180889466 Ser TGA t GCtc aagtattgca G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A C G A G | + | | | G G G A C A G G G G G C G | | | T T C A T G T C G A G TGTGCGCCTGGCGCACC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |