Sequence ID | >WENV180889933 |
Genome ID | ODMN01253304 |
Search identical group | |
Phylum/Class | [ODMN] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 75 |
End posion on genome | 1 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ccgtcggcac |
tRNA gene sequence |
GCCCCCTTAGCTCAGTTGGTCAGAGCTGCGGACTTTTAATCCGAAGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV180889933 Lys TTT c ACnn nnnnnnnnnn G + T C - G C - G C - G C - G C - G T - A C G T C A C C C A T G A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T C A T AGGTC G A C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |