Sequence ID | >WENV180895705 |
Genome ID | ODNE01001199 |
Search identical group | |
Phylum/Class | [ODNE] human metagenome; G_DNA_Anterior nares |
Species | |
Start position on genome | 358 |
End posion on genome | 431 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ctcatccgtt |
tRNA gene sequence |
GCCCCTATAGCTCAGTAGGCAGAGCGTCTCCATGGTAAGGAGAAGGTCAGCAGTTCGATT |
Downstream region at tRNA end position |
agtgtgaatc |
Secondary structure (Cloverleaf model) | >WENV180895705 Thr GGT t TCtg agtgtgaatc G - C C - G C - G C - G C - G T + G A - T T T T T C G T C A T G A A | | | | | G A C T C G A G C A G C G | | | | T T G G A G C C A G AGGTC T - A C - G T - A C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |