Sequence ID | >WENV180895812 |
Genome ID | ODNG01000316 |
Search identical group | |
Phylum/Class | [ODNG] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 519 |
End posion on genome | 594 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tgggcacgat |
tRNA gene sequence |
GGCCGGGTAGCTCAGTTGGTAGTAGCGTTCGCCTGAAAAGTGAAAGGTCACCGGTTCGAC |
Downstream region at tRNA end position |
tgcaaatgac |
Secondary structure (Cloverleaf model) | >WENV180895812 Phe GAA t ACCt tgcaaatgac G - C G - C C - G C - G G - C G - C G - C C C T T G G C C A T G A A | | | | | G T C T C G A C C G G C G | | | T T G T A G C T A G G AGGTC T - A T - A C - G G + T C - G C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |