Sequence ID | >WENV180898697 |
Genome ID | ODNU01000318 |
Search identical group | |
Phylum/Class | [ODNU] human metagenome; G_DNA_Subgingival plaque |
Species | |
Start position on genome | 1263 |
End posion on genome | 1188 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GGGGTTATAGCTCAGTTGGTAGAGCGCCTGCCTTGCACGCAGGAGGTCAGGAGTTCGACT |
Downstream region at tRNA end position |
cttacaataa |
Secondary structure (Cloverleaf model) | >WENV180898697 Ala TGC n ACCA cttacaataa G - C G - C G + T G - C T - A T - A A - T T C T T C C T C A T G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C T A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |