Sequence ID | >WENV180900245 |
Genome ID | ODOJ01000789 |
Search identical group | |
Phylum/Class | [ODOJ] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 961 |
End posion on genome | 886 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
ttatagatat |
tRNA gene sequence |
CGCGGGGTAGAGCAGTTGGTAGCTCGTCGGGCTCATAACCCGGAGGTCGCAGGTTCAAGT |
Downstream region at tRNA end position |
acgaaaagta |
Secondary structure (Cloverleaf model) | >WENV180900245 fMet CAT t ACCA acgaaaagta C A G - C C - G G - C G - C G - C G - C T G T T G T C C A T G A A + | | | | A T C G A G G C A G G C G | | | | T T G G C T C T A G AGGTC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |