Sequence ID | >WENV180903655 |
Genome ID | ODOZ01001721 |
Search identical group | |
Phylum/Class | [ODOZ] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 173 |
End posion on genome | 247 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ggaggtccac |
tRNA gene sequence |
GGGGCATTGGCGCAGTTGGTAGCGCGGCTGCTTTGCAAGCAGTAGGTCAGGGGTTCGAGT |
Downstream region at tRNA end position |
cacgcacaag |
Secondary structure (Cloverleaf model) | >WENV180903655 Ala TGC c ACCc cacgcacaag G - C G - C G + T G - C C - G A - T T - A T G T T C C C C A T G A G | | | | | G T C G C G A G G G G C G | | | | T T G G C G C T A G AGGTC G + T C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |