Sequence ID | >W08005642 |
Genome ID | ABIB01000025 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Kordia algicida OT-1 [ABIB] |
Start position on genome | 9670 |
End posion on genome | 9744 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaaatgatta |
tRNA gene sequence |
GGTCGCGTAGCTCAGCTGGATAGAGCATCTGCCTTCTAAGCAGACGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
gagcggacaa |
Secondary structure (Cloverleaf model) | >W08005642 Arg TCT a ACag gagcggacaa G - C G + T T - A C - G G - C C - G G - C T A T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A T A A CGGTC T - A C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |