Sequence ID | >WENV180906906 |
Genome ID | ODPU01001403 |
Search identical group | |
Phylum/Class | [ODPU] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 244 |
End posion on genome | 169 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ataacttcat |
tRNA gene sequence |
GGCCCCGTAGTGCAGCGGCCTAGCACGCGGCCCTCTCAAGGCTGAAACGGCGGTTCGAAT |
Downstream region at tRNA end position |
atggtagatg |
Secondary structure (Cloverleaf model) | >WENV180906906 Glu CTC t ACCA atggtagatg G + T G - C C - G C - G C - G C - G G - C T A T T C G C C A C G A A + | | | | G G C G T G G G C G G C G | | | | T T C G C A C C T A G AAAC C - G G + T G - C C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |