Sequence ID | >WENV180920288 |
Genome ID | ODTH01003089 |
Search identical group | |
Phylum/Class | [ODTH] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 4312 |
End posion on genome | 4387 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
caccccattt |
tRNA gene sequence |
GCGTCATTAGCTCAGTTGGTAGAGCACACGACTTTTAATCGTGTTGTCACAAGTTCAAAT |
Downstream region at tRNA end position |
ttttttgcgg |
Secondary structure (Cloverleaf model) | >WENV180920288 Lys TTT t ACCA ttttttgcgg G - C C - G G - C T - A C - G A - T T - A T A T T G T T C A T G A A | | | | | A T C T C G A C A A G C G | | | | T T G G A G C T A A TTGTC C - G A - T C - G G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |