Sequence ID | >WENV180920428 |
Genome ID | ODTH01005753 |
Search identical group | |
Phylum/Class | [ODTH] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 3646 |
End posion on genome | 3722 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ataccgttag |
tRNA gene sequence |
CGGGACGTGGCGCAGCTTGGTAGCGCGCTTCCTTGGGGTGGAAGAGGTCGCGAGTTCAAA |
Downstream region at tRNA end position |
catgaaaaga |
Secondary structure (Cloverleaf model) | >WENV180920428 Pro GGG g ACCA catgaaaaga C - G G - C G - C G + T A - T C - G G - C T A T C G C T C A C G A G | | | | | A T C G C G G C G A G C T | | | | T T G G C G C G T A G AGGTC C - G T - A T - A C - G C - G T T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |