Sequence ID | >WENV180924886 |
Genome ID | ODTK01021100 |
Search identical group | |
Phylum/Class | [ODTK] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 799 |
End posion on genome | 724 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aacatagatG |
tRNA gene sequence |
GTGGTCTTAGCTCAGTTGGTTAGAGCGTCGGATTGTGGTTCCGAAGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
aataaaaaaa |
Secondary structure (Cloverleaf model) | >WENV180924886 His GTG G CCtg aataaaaaaa G - C T - A G - C G - C T T C T T - A C G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T T A G AGGTC T - A C - G G - C G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |