Sequence ID | >WENV180929649 |
Genome ID | ODTN01007608 |
Search identical group | |
Phylum/Class | [ODTN] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 827 |
End posion on genome | 756 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ctaattattg |
tRNA gene sequence |
GGTGCCTGGGCCGGTCGGTTAGGTAACGGTCTGCAAAACCGTGTAGAGCAGTTCGATTCT |
Downstream region at tRNA end position |
aagtccgaag |
Secondary structure (Cloverleaf model) | >WENV180929649 Cys GCA g TCaa aagtccgaag G - C G - C T - A G - C C - G C - G T - A T T G T C G T C A T G G | | | | | G C G C C G A G C A G C G | | + T T G A G G T T T A GTAG A - T C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |