Sequence ID | >WENV180934613 |
Genome ID | ODTS01000724 |
Search identical group | |
Phylum/Class | [ODTS] human metagenome; G_DNA_Subgingival plaque |
Species | |
Start position on genome | 3645 |
End posion on genome | 3570 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ccggccgcgc |
tRNA gene sequence |
GCCGCTTTAGCTCAGTTGGTAGAGCAGCTGTCTTGTAAACAGCAGGTCGTCGGTTCGAGT |
Downstream region at tRNA end position |
ctcatcgccc |
Secondary structure (Cloverleaf model) | >WENV180934613 Thr TGT c TCCA ctcatcgccc G - C C - G C - G G - C C - G T - A T - A T G T C A G C C A T G A A | | | | | G T C T C G G T C G G C G | | | | T T G G A G C T A A AGGTC G - C C - G T - A G - C T - A C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |