Sequence ID | >WENV180935112 |
Genome ID | ODTS01060684 |
Search identical group | |
Phylum/Class | [ODTS] human metagenome; G_DNA_Subgingival plaque |
Species | |
Start position on genome | 226 |
End posion on genome | 302 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cgtgaatagt |
tRNA gene sequence |
TGGGGATTCGCCAAGTTGGTTAAGGCACCGGATTTTGATTCCGGCATTCGTAGGTTCGAA |
Downstream region at tRNA end position |
aacacaacta |
Secondary structure (Cloverleaf model) | >WENV180935112 Gln TTG t GCCA aacacaacta T - A G - C G - C G - C G - C A - T T - A T A T C A T C C A T G A C | | | | | G T A C C G G T A G G C G | | | T T G A G G C T T A A CATTC C - G C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |