Sequence ID | >WENV180937019 |
Genome ID | ODTV01005153 |
Search identical group | |
Phylum/Class | [ODTV] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 114 |
End posion on genome | 40 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
aaaaaggact |
tRNA gene sequence |
GGTCTCATAGCTCAGTCGGTTAGAGCATCTGACTCATAATCAGAGGGTCGTTGGTTCGAG |
Downstream region at tRNA end position |
taaggggtaa |
Secondary structure (Cloverleaf model) | >WENV180937019 Ile2 CAT t ACta taaggggtaa G - C G - C T - A C - G T + G C - G A - T C G T C A A C C A T G A A | | | | | G C C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |