Sequence ID | >WENV180937946 |
Genome ID | ODTX01000263 |
Search identical group | |
Phylum/Class | [ODTX] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 33884 |
End posion on genome | 33809 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tgtcctcatT |
tRNA gene sequence |
GCCCCCATAGCCCAATCGGCAGAGGCAGTTGACTTAAAATCAATTCAGTGTGGGTTCGAG |
Downstream region at tRNA end position |
atagcgcata |
Secondary structure (Cloverleaf model) | >WENV180937946 Leu TAA T ATtg atagcgcata G - C C - G C - G C - G C - G C - G A - T T G T C A C C C A T A A A | | | | | G C C C C G G T G G G C G | | | T T G A G G C C A G A TCAGT G + T T - A T - A G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |