Sequence ID | >WENV180938974 |
Genome ID | ODTX01011205 |
Search identical group | |
Phylum/Class | [ODTX] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 612 |
End posion on genome | 687 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
agatggtatT |
tRNA gene sequence |
GGTCTCATAGCTCAGCTGGATAGAGCATTCGCCTTCTAAGCGAACGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
aggcaaaaaa |
Secondary structure (Cloverleaf model) | >WENV180938974 Arg TCT T AGaa aggcaaaaaa G - C G + T T - A C - G T - A C - G A - T T A T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A CGGTC T - A T - A C - G G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |