Sequence ID | >WENV180939197 |
Genome ID | ODTX01019920 |
Search identical group | |
Phylum/Class | [ODTX] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 674 |
End posion on genome | 747 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
tagaccgcac |
tRNA gene sequence |
GGGCGATTGGCGCAGTGGTAGCGCGCTTCGTTCACACCGAAGAGGTCGGCGGTTCGAAAC |
Downstream region at tRNA end position |
atgctcctca |
Secondary structure (Cloverleaf model) | >WENV180939197 Val CAC c ACCg atgctcctca G - C G - C G - C C - G G - C A - T T - A A A T C C G C C A G A G | | | | | G T C G C G G G C G G C G | | | | T T G G C G C T A G AGGTC C - G T - A T - A C - G G - C T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |