Sequence ID | >WENV180943322 |
Genome ID | ODUC01000207 |
Search identical group | |
Phylum/Class | [ODUC] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 13692 |
End posion on genome | 13617 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
gagatgctat |
tRNA gene sequence |
GGGGTATTAGCTCATCTGGCTAGAGCGCGACACTGGCAGTGTCGAGGTGAGCGGTTCGAG |
Downstream region at tRNA end position |
tgaggaatat |
Secondary structure (Cloverleaf model) | >WENV180943322 Ala GGC t ACCg tgaggaatat G - C G - C G + T G - C T - A A - T T - A T G T T C G C C A C T A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C C T A G AGGTG C - G G - C A - T C - G A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |