Sequence ID | >WENV180944156 |
Genome ID | ODUC01009245 |
Search identical group | |
Phylum/Class | [ODUC] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 1944 |
End posion on genome | 2018 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ttgggggcag |
tRNA gene sequence |
GCCCTCGTAGCTCAGGGGATAGAGCACCGCTCTCCTAAAGCGGGTGTCGCGCGTTCGAAT |
Downstream region at tRNA end position |
agtgcgcaag |
Secondary structure (Cloverleaf model) | >WENV180944156 Arg CCT g ACCc agtgcgcaag G - C C - G C - G C - G T + G C - G G - C T A T C G C G C A G G A A | | | | | G G C T C G G C G C G C G | | | | T T A G A G C T A A GTGTC C - G C - G G - C C - G T - A C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |