Sequence ID | >WENV180944601 |
Genome ID | ODUC01025131 |
Search identical group | |
Phylum/Class | [ODUC] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 1707 |
End posion on genome | 1782 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
cgcgtcaccc |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCGCATCCCTGATAAGGATGAGGTCGCTGGTTCGAG |
Downstream region at tRNA end position |
cccgcggtgg |
Secondary structure (Cloverleaf model) | >WENV180944601 Ile GAT c ACCg cccgcggtgg G - C G - C G - C C - G C - G T - A A - T T G T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T T - A C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |