Sequence ID | >WENV180944968 |
Genome ID | ODUC01053296 |
Search identical group | |
Phylum/Class | [ODUC] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 237 |
End posion on genome | 325 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ggaaggcgat |
tRNA gene sequence |
GGAGATGTCGCATAGTGGCCTAGTGCGCCTCCCTGCTAAGGAGGTTGGGGTGGAAGCCCC |
Downstream region at tRNA end position |
gactgatgag |
Secondary structure (Cloverleaf model) | >WENV180944968 Ser GCT t GCCg gactgatgag G - C G - C A - T G - C A - T T - A G - C T A T C C C T C A T G A C | | | | | G G T A C G G G G A G C G + | | | T T C G T G C C T A G TTGGGGTGGAAGCCCCTC C - G C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |