Sequence ID | >WENV180945039 |
Genome ID | ODUC01061370 |
Search identical group | |
Phylum/Class | [ODUC] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 765 |
End posion on genome | 836 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
taacaacaat |
tRNA gene sequence |
GGTGCTTGGGCCGGGAGGTTAGGCAATGGTCTGCAAAACCATGTAGAGCGGTTCGATTCC |
Downstream region at tRNA end position |
gaaagactct |
Secondary structure (Cloverleaf model) | >WENV180945039 Cys GCA t TCaa gaaagactct G - C G - C T - A G - C C - G T + G T - A T T G T C G C C A G G G | | | | | G A G C C G A G C G G C G | | | T T G A G G C T T A GTAG A - T T - A G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |