Sequence ID | >WENV180949406 |
Genome ID | ODUG01016138 |
Search identical group | |
Phylum/Class | [ODUG] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 2398 |
End posion on genome | 2323 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GCCGCTTTAGCTCATCTGGTAGAGCAACTGACTTGTAATCAGTAGGTGGTTGGTTCGAGT |
Downstream region at tRNA end position |
tagaaaaatt |
Secondary structure (Cloverleaf model) | >WENV180949406 Thr TGT n ACCA tagaaaaatt G - C C - G C - G G - C C - G T - A T - A T G T C A G C C A C T A A | | + | | G T C T C G G T T G G C G | | | | T T G G A G C T A A AGGTG A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |