Sequence ID | >W08011060 |
Genome ID | ABSG01000003 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Nitrosococcus oceani C-27 [ABSG] |
Start position on genome | 123936 |
End posion on genome | 123863 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tattatctct |
tRNA gene sequence |
GCCCCGGTAGCTCAGCTGGATAGAGCATCCCCCTCCTAAGGGGAAGGTCATACGTTCGAA |
Downstream region at tRNA end position |
tttaaatata |
Secondary structure (Cloverleaf model) | >W08011060 Arg CCT t Gcca tttaaatata G - C C - G C - G C - G C - G G - C G - C T A T T A T G C A C G A A | | | | | G T C T C G A T A C G C G | | | | T T G G A G C A T A A AGGTC T - A C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |