Sequence ID | >WENV180950681 |
Genome ID | ODUH01000731 |
Search identical group | |
Phylum/Class | [ODUH] human metagenome; G_DNA_Subgingival plaque |
Species | |
Start position on genome | 6167 |
End posion on genome | 6241 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
tttacaaaaa |
tRNA gene sequence |
GGCCGCGTAGTTCAACTGGATAGAATATCAGATTTCGGCTCTGAGGGTTGGGGGTTCGAA |
Downstream region at tRNA end position |
aggctgttca |
Secondary structure (Cloverleaf model) | >WENV180950681 Arg TCG a ACaa aggctgttca G - C G + T C - G C - G G - C C - G G - C G A T T C T C C A C A A A + | + | | G T C T T G G G G G G C G | | | + T T G G A A T A T A A GGGTT T - A C - G A - T G - C A - T T C T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |