Sequence ID | >W141093410 |
Genome ID | AVBD01000022 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Staphylococcus equorum UMC-CNS-924 [AVBD] |
Start position on genome | 14543 |
End posion on genome | 14470 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
agtttttatt |
tRNA gene sequence |
GGCGGCATAGCCAAGTGGTAAGGCAGAGGTCTGCAAAACCTCTATCACCGGTTCAAATCC |
Downstream region at tRNA end position |
tcaatatgcg |
Secondary structure (Cloverleaf model) | >W141093410 Cys GCA t TCCA tcaatatgcg G - C G - C C - G G - C G - C C - G A - T T A T T G G C C A G A A | | | | | A T A C C G A C C G G C G | | | T T G A G G C T A A TATC G - C A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |