Sequence ID | >WENV180957447 |
Genome ID | ODUK01048044 |
Search identical group | |
Phylum/Class | [ODUK] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 473 |
End posion on genome | 399 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tcaatatttc |
tRNA gene sequence |
GGCACCATAGCCAAGCGGTAAGGCAGAGGTCTGCAAAACCTTTATTCCCCAGTTCGATTC |
Downstream region at tRNA end position |
agtcttctgg |
Secondary structure (Cloverleaf model) | >WENV180957447 Cys GCA c TCCA agtcttctgg G - C G - C C - G A - T C - G C - G A - T T T T G G G T C A G A A | | | | | G C A C C G C C C A G C G | | | T T G A G G C T A A TATTC G + T A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |