Sequence ID | >WENV180964738 |
Genome ID | ODUO01015101 |
Search identical group | |
Phylum/Class | [ODUO] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 1125 |
End posion on genome | 1049 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
taatccacat |
tRNA gene sequence |
GGTTCAGTAGCTCAGTTGGATAGAGCAACGGCCTTCTAAGCCGTGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
ctaagaatgc |
Secondary structure (Cloverleaf model) | >WENV180964738 Arg TCT t ACCA ctaagaatgc G - C G + T T - A T + G C - G A - T G - C T A T C T C C C A T G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |