Sequence ID | >WENV180968935 |
Genome ID | ODUT01126186 |
Search identical group | |
Phylum/Class | [ODUT] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 177 |
End posion on genome | 101 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tacgtttcct |
tRNA gene sequence |
GCGGTTGTAGCTCAGATGGATAGAGCATCTGCCTCCTAAGCAGAGGGTCGCGCGTTCGAC |
Downstream region at tRNA end position |
tacggacata |
Secondary structure (Cloverleaf model) | >WENV180968935 Arg CCT t ACCA tacggacata G - C C - G G - C G + T T - A T - A G - C T C T C G C G C A A G A A | | | | | G T C T C G G C G C G C G | | | | T T G G A G C A T A A GGGTC T - A C - G T - A G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |