Sequence ID | >WENV180973542 |
Genome ID | ODUW01007885 |
Search identical group | |
Phylum/Class | [ODUW] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 1370 |
End posion on genome | 1445 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gagaacattc |
tRNA gene sequence |
GACGGGGTAGCTCAGTCGGTAGAGCAAGCGGCTCATAATCGCTGTGTCGCGGGTTCAAGT |
Downstream region at tRNA end position |
cacaaccgaa |
Secondary structure (Cloverleaf model) | >WENV180973542 Met CAT c ACCA cacaaccgaa G - C A - T C - G G - C G + T G - C G - C T G T C G C C C A T G A A | | | | | A C C T C G G C G G G C G | | | | T T G G A G C T A A GTGTC A - T G - C C - G G - C G + T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |