Sequence ID | >WENV180976942 |
Genome ID | ODUY01359526 |
Search identical group | |
Phylum/Class | [ODUY] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 130 |
End posion on genome | 205 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cgtgtttttt |
tRNA gene sequence |
GAGCCGTTAGCTCAGTCGGTAGAGCACCGGACTTTTAATCCGGGTGTCGTGGGTTCAAGT |
Downstream region at tRNA end position |
gtccaatttc |
Secondary structure (Cloverleaf model) | >WENV180976942 Lys TTT t ACCA gtccaatttc G - C A - T G - C C - G C - G G - C T - A T G T C A C C C A T G A A | | | | | A C C T C G G T G G G C G | | | | T T G G A G C T A A GTGTC C - G C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |