Sequence ID | >WENV180982454 |
Genome ID | ODVF01000022 |
Search identical group | |
Phylum/Class | [ODVF] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 95116 |
End posion on genome | 95040 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
atgcgccgtt |
tRNA gene sequence |
CGGGGTGTAGCGTAGCCTGGTAGCGCGCCTGGTTTGGGACCAGGATGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
gcacaactcg |
Secondary structure (Cloverleaf model) | >WENV180982454 Pro TGG t ACCA gcacaactcg C - G G - C G - C G - C G - C T - A G - C T A T C T C T C A C G A A | + | | | G C T G C G G G G A G C T + | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |