Sequence ID | >WENV180986561 |
Genome ID | ODVK01000089 |
Search identical group | |
Phylum/Class | [ODVK] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 23724 |
End posion on genome | 23795 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aattgggaat |
tRNA gene sequence |
TGGTCTATGGTGTAATGGTAACACAGCAGATTTTGGTTCTGTTATTCAAGGTTCGAGTCC |
Downstream region at tRNA end position |
tttagaaatt |
Secondary structure (Cloverleaf model) | >WENV180986561 Gln TTG t ACaa tttagaaatt T - A G - C G - C T - A C - G T - A A - T T G T G T T C C A A A G | | | | | G T T G T G C A A G G C G | | | | T T G A C A C T A A TATT G + T C - G A - T G - C A - T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |