Sequence ID | >WENV180996226 |
Genome ID | ODVR01163080 |
Search identical group | |
Phylum/Class | [ODVR] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 112 |
End posion on genome | 185 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tttattttaT |
tRNA gene sequence |
TGGGCTATCGCCAAGCGGTAAGGCACAGGACTTTGACTCCTGCATTCGTTGGTTCGAATC |
Downstream region at tRNA end position |
ttatgggcgt |
Secondary structure (Cloverleaf model) | >WENV180996226 Gln TTG T GTtt ttatgggcgt T - A G - C G - C G - C C - G T - A A - T T A T C A A C C A G A C | | | | | G C A C C G G T T G G C G | | | T T G A G G C T A A CATTC C - G A - T G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |