Sequence ID | >WENV180998727 |
Genome ID | ODVT01001610 |
Search identical group | |
Phylum/Class | [ODVT] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 4407 |
End posion on genome | 4333 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aatataacac |
tRNA gene sequence |
TCCTCCTTAGCTCAGTTGGTTAGAGCATCTGACTGTTAATCAGAGGGTCACTGGTTCAAG |
Downstream region at tRNA end position |
aagaaaaagg |
Secondary structure (Cloverleaf model) | >WENV180998727 Asn GTT c GCaa aagaaaaagg T - A C - G C - G T + G C - G C - G T - A T G T T G A C C A T G A A | | | | | A T C T C G A C T G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |