Sequence ID | >WENV181004702 |
Genome ID | ODVY01000257 |
Search identical group | |
Phylum/Class | [ODVY] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 16247 |
End posion on genome | 16319 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
aatttgaagc |
tRNA gene sequence |
GGCCTTGTAGTTCAACGGATAGAATAGAAGTTTCCTAAACTTTAGATAGGGGTTCGATTC |
Downstream region at tRNA end position |
cgaagaatct |
Secondary structure (Cloverleaf model) | >WENV181004702 Arg CCT c ACta cgaagaatct G + T G - C C - G C - G T + G T + G G - C T T T T C C C C A C A A A | | | | | G G C T T G A G G G G C G | | | + T T A G A A T T A A AGAT G + T A - T A - T G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |