Sequence ID | >WENV181008412 |
Genome ID | ODWE01005043 |
Search identical group | |
Phylum/Class | [ODWE] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 3834 |
End posion on genome | 3759 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gtgcccacct |
tRNA gene sequence |
GCCTCCGTAGCTCAGCGGCCAGAGCGCTCGCCTTGTAAGCGAGTGGTCGAGGGTTCGACT |
Downstream region at tRNA end position |
ttcatcctta |
Secondary structure (Cloverleaf model) | >WENV181008412 Thr TGT t TCCA ttcatcctta G - C C - G C - G T + G C - G C - G G - C T C T C T C C C A C G A A | | | | | G G C T C G G A G G G C G | | | | T T C G A G C C A G TGGTC C - G T - A C - G G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |