Sequence ID | >WENV181010619 |
Genome ID | ODWH01109760 |
Search identical group | |
Phylum/Class | [ODWH] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 158 |
End posion on genome | 82 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccaccattat |
tRNA gene sequence |
GCCTAGGTAGCTCAGTTGGCTAGAGCATACGGTTCATACCCGTACGGTCGATGGTTCGAA |
Downstream region at tRNA end position |
ttactgataa |
Secondary structure (Cloverleaf model) | >WENV181010619 Met CAT t ACCA ttactgataa G - C C - G C - G T - A A - T G - C G - C T A T T T A C C A T G A A + | | | | G T C T C G G A T G G C G | | | | T T G G A G C C T A A CGGTC T - A A - T C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |