Sequence ID | >WENV181012142 |
Genome ID | ODWJ01026122 |
Search identical group | |
Phylum/Class | [ODWJ] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 144 |
End posion on genome | 68 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
cttaagggat |
tRNA gene sequence |
GACCCCGTAGCTCAATTGGATAGAGTGACTCCCTCCTAAGGAGTAGGTTGTGTGTTCAAG |
Downstream region at tRNA end position |
ttttataaaa |
Secondary structure (Cloverleaf model) | >WENV181012142 Arg CCT t GCCA ttttataaaa G - C A - T C - G C - G C - G C - G G + T C G T T A C A C A T A A A + | | | | A T C T C G G T G T G C G | | | + T T G G A G T A T A G AGGTT A - T C - G T - A C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |