Sequence ID | >WENV181017116 |
Genome ID | ODWR01026771 |
Search identical group | |
Phylum/Class | [ODWR] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 303 |
End posion on genome | 376 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
aaacaaataa |
tRNA gene sequence |
GCGCCTCTAGCTCAATTGGCAGAGCAATTGACTCTTAATCAATGGGTTCTGGGTTCGAGT |
Downstream region at tRNA end position |
caaagaaaat |
Secondary structure (Cloverleaf model) | >WENV181017116 Lys CTT a ACtt caaagaaaat G - C C - G G - C C - G C - G T + G C - G T G T G A C C C A T A A A | | | | | G T C T C G C T G G G C G | | | | T T G G A G C C A A GGGTT A - T T - A T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |