Sequence ID | >WENV181017313 |
Genome ID | ODWR01047822 |
Search identical group | |
Phylum/Class | [ODWR] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 343 |
End posion on genome | 269 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tccaccacat |
tRNA gene sequence |
GCGGGAATAGCTCAGCGGTAGAGCACCGCCTTGCCAAGGCGGGGGTCGCGAGTTCGAATC |
Downstream region at tRNA end position |
ttaatattcc |
Secondary structure (Cloverleaf model) | >WENV181017313 Gly GCC t TCCA ttaatattcc G - C C - G G - C G - C G - C A - T A - T T A T T G C T C A G A A + | | | | G C C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC C - G C - G G - C C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |