Sequence ID | >WENV181019840 |
Genome ID | ODWU01018713 |
Search identical group | |
Phylum/Class | [ODWU] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 177 |
End posion on genome | 101 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
cgcaccatat |
tRNA gene sequence |
GGGGATATAGCTCAGTTTGGGAGAGCGACGCACTTGCACTGCGTAGGTCAGCGGTTCGAT |
Downstream region at tRNA end position |
ttaaattatc |
Secondary structure (Cloverleaf model) | >WENV181019840 Ala TGC t ACCA ttaaattatc G - C G - C G + T G - C A - T T - A A - T C T T T C G C C A T G A A | | | | | G T C T C G A G C G G C T | | | | T T G G A G C G G A G AGGTC A - T C - G G - C C - G A - T C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |