Sequence ID | >WENV181021384 |
Genome ID | ODWV01009280 |
Search identical group | |
Phylum/Class | [ODWV] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 759 |
End posion on genome | 686 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
aacagaataa |
tRNA gene sequence |
GCGCCTCTAGCTCAATTGGCAGAGCAATTGACTCTTAATCAATGGGTTCTGGGTTCGAGT |
Downstream region at tRNA end position |
caagaaagat |
Secondary structure (Cloverleaf model) | >WENV181021384 Lys CTT a ACat caagaaagat G - C C - G G - C C - G C - G T + G C - G T G T G A C C C A T A A A | | | | | G T C T C G C T G G G C G | | | | T T G G A G C C A A GGGTT A - T T - A T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |